Is it true? Can Covid-19 vaccines connect me to the internet?
health.gov.au
health.gov.au
Yes. Sarcasm.
On the other hand it is a quiet serious issue.
While deployed to the Solomon Islands 15 years ago in a very remote location, the indigenous folks thought our helicopters were stealing all their gold and diamonds with giant vacuum cleaners in our helicopters.
Comically ridiculous, but they were serious as a heart attack.
And there were a few very aggressively and violently leveraged those mistaken beliefs.
So we had to respond with great care for their concerns rather than just disparaging them.
Doesn’t the same apply here?
Confirmation bias of internet searches and conformity bias of online fringe communities can lead to quite persistent and amplified opposition.
Can I connect to my smart home so I can turn on the lights without saying a word?
Reencrypting a memory is hard, right?
Science doesn't stay still. Given these it is no surprise that lay person think that this is possible.
Silence is death for any idea. An idea that is never spoken or written down dies with the person who conceived it. Ideas can only be remembered when they are repeated. They can only be believed when they are repeated.”
James Clear
People believe it's a serious issue now which distracts from real issues.
Unless they're using the 'voltswagen' NTP server :P /lamejoke
The good thing is that you get a free subscription to xCloud and you can play Xbox with your mind. If you get the extra vaccine you get also bluetooth support and you can use a joystick.
The goal, I think, is to emphasise the really wacky stuff so that anyone who might have more nuanced concerns about a vaccine (or anything else that differs from the "correct" narrative) gets lumped in with the crazies, and therefore shamed into keeping quiet.
The UK government, for example, has openly used psyops tactics on its own population for the duration of the pandemic, so I don't think it's too much of a reach to say that this could be another example of it.
> The perceived level of personal threat needs to be increased among those who are complacent, using hard-hitting emotional messaging. From the minutes of SPI-B, the UK government's pandemic psyops group
https://evidencenotfear.com/how-sage-and-uk-media-created-fe...
Compulsory disclaimer that I'm not an anti-vaxxer, I will almost certainly take the vaccine as soon as it's offered to me. I'm just someone who thinks that a government using these fear based tactics on its own people is utterly shameful.
https://twitter.com/MoonbaseOtago/status/1370922507146985478
Can't the human body be used as an antenna?
Just saying, A fool can ask more questions than seven wise men can answer.
It appears large swaths of people are getting knowledge of the sciences from popular entertainment. Of course they do impossible things all the time in fiction, but too many people seemingly can't distinguish the impossible things from the possible, so we end up with jurors that think "DNA" is the answer to every crime scene question, and people thinking "nanotech" can recreate magic.
I'm not sure how to fix this. The long term effects of devaluing knowledge scares me, though.
Despite this bullshit, having so small internet connected chips would enable a lot new usages. Would be very interesting times.
and, a clone of haveibeenpwned will popup asking people to enter their brain scans to check if their brain was in the leaked dataset :)
GCCAGTGAGTGAGTAAGTATATCCACTTACTTGTGTGTGTGTGTACTCGTC GGCTTGTGGGTGAGTGGGCACGCGGACTCGCATGCTTGCTGACTTGTGTGC AGGTGAGCATGCCAATTTGTGCATTGGCGAGGAGGTGTATGAGTGTATCGG GGTGCGTGGCAGCATGGAGAAAAAAAA
A more helpful question would have been “Can I be spied/tracked after I’m vaccinated” or something along those lines.
The answer to which is obviously yes. You don't become invisible after taking the vaccines, for example.
"Doctor will I be able to play the piano after the operation?" "Yes" "Cool! I was never able to play it"
people who could believe that could believe anything
Curiously, does this mean that the Pfizer vaccine is the only one Australia is using/has access to currently?
It's a good thing too that we have a domestic cabability, as other countries appear to be diverting previously promised doses elsewhere because of Australia's successful covid-19 control programs.
Note: happy to be corrected on any of this. Also, no judgement on the diverting of vaccine doses to more at risk populations, it seems sensible.
Requirements:
* it's a "vaccine" in that it's something introduced into your body to prompt your body to make something else itself
* either you can access some information from the internet or you can be accessed in some way from the internet or both
* assume the patient has a smartphone with data access