> Why would he expect aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to be less random than for example acatgagacgtctaatgttagacatgcatgac?

Can we really consider any part of a genome random? I means your second example isn't part of it, so I guess it's "random" but if you compare any part, it would come from evolution and without this, the virus wouldn't survive most probably (or at least, not like it does currently).

What makes special aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa is that it's a pattern that we can spot easily. I'm pretty sure that any other patterns would make us curious about whether it's important or not. It seems like something that is graspable.

I would bet that 99+% of arrangements of 33 letters "look random" -- that is, there is no discernible pattern. Despite each arrangement having an equally tiny probability of occurring, if you randomly generate an arrangement, you're all but guaranteed to get something that looks random.

For aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to appear, it is either an amazing coincidence, or there must be some non-random mechanism that creates it.

While intuitively my instinct is to say "well, of course it's not random", but statistically, I don't know how to explain it...